rs1379736 chr8:86792081 A>G
- Sequence
aaggagtgcacccccttgtggaat[A/G]gtcggttatttgacaggtacagga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) IPSC-derived bipolar neuron bipolar neuron GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.17 | 1.17 | 1.33 | |||
| IPSC-derived bipolar neuron | 1.85 | -1.59 | 1.00 | |||
| bipolar neuron | 1.44 | -2.79 | 1.25 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.70 | -1.48 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.58 | -1.18 | 1.00 |
Items per page:
1 – 5 of 6