rs1379740 chr8:86871209 G>A
- Sequence
caggaaatggtgaagtaaattgca[G/A]tgccttgcaaatcacatctccact
- ASB in cell types
- foreskin keratinocyte THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.60 | 2.64 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 1.36 | 0.21 | 2.00 |
Items per page:
1 – 2 of 2