rs1380062 chr4:55160022 A>G
- Sequence
agagggtccctggagggtaaagac[A/G]gtttgcaaagtcagtgtgattcat
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NALM-6 (adult B acute lymphoblastic leukemia) | 0.13 | 1.36 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, infant head circumference, systolic blood pressure (sbp)