rs1382099 chr4:18456291 A>G
- Sequence
taatttatcatttaaagcaatatt[A/G]tgatcaagtcattgataatgtgac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN GATA3_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.04 | 1.59 | 2.06 | n/a | No Hit | |||
| GATA3_HUMAN | -0.90 | 1.89 | 2.00 | n/a | No Hit | |||
| FOXA1_HUMAN | -0.29 | 1.35 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, obesity with early age of onset (age >2)