rs1382582 chr1:237562424 A>G
- Sequence
agatcttgactgccctctagtggc[A/G]tatattttcttagctatattgttt
- ASB in cell types
- foreskin keratinocyte SH-SY5Y (neuroblastoma) KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.90 | n/a | 2.33 | |||
| SH-SY5Y (neuroblastoma) | 1.65 | n/a | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | n/a | 0.97 | 3.50 |
Items per page:
1 – 3 of 3