rs138466 chr22:38513226 T>C
- Sequence
cagcaggaacagcctggtcaggcc[T/C]ctgccactgctgctaggccctgct
- ASB in cell types
- PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 2.35 | -1.27 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid