rs1384878 chr8:86106461 G>T
- Sequence
atctcatctttagatggtatctcc[G/T]tggcctaactcccagttcactggg
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- PRD10_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | n/a | 2.85 | 1.33 | n/a | n/a | |||
| GCR_HUMAN | -2.24 | 2.36 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, amyotrophic lateral sclerosis (als), fasting blood glucose, neuroblastoma (brain cancer), variant creutzfeldt-jakob disease