rs1385374 chr12:128816149 C>T
- Sequence
caaacaaaagcactgaggtaataa[C/T]gcaacatctaggcttatggagttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.72 | -4.30 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), drug-induced liver injury-all cholestatic dili cases not due to flucloxacillin or amoxicillin/clavulanate, drug-induced liver injury-all dili cases presenting with rash, drug-induced liver injury-all dili cases with a tetracycline antibiotic implicated, selective immunoglobulin a deficiency (igad), simpson-angus scale, systemic lupus erythematosus (sle), systolic blood pressure (sbp)
PheWAS abnormal findings on examination of urine, abnormal findings on study of brain, nervous system, acute and chronic tonsillitis, acute pancreatitis, acute tonsillitis, anal and rectal conditions, anal and rectal polyp, aneurysm of other specified artery, anomalies of jaw size/symmetry, anxiety, phobic and dissociative disorders, aphakia and other disorders of lens, benign neoplasm of other endocrine glands, bone cancer, calculus of bile duct, calculus of lower urinary tract, cardiac congenital anomalies, cardiomyopathy, cholelithiasis, chronic obstructive asthma, convulsions, corneal dystrophy, degenerative disease of the spinal cord, delirium dementia and amnestic disorders, dementias, dermatophytosis of nail, disorders of external ear, eating disorder, eosinophilia, epilepsy, epilepsy, recurrent seizures, convulsions, epiphora, exostosis of jaw, fracture of ankle and foot, fracture of radius and ulna, fracture of unspecified bones, fracture of upper limb, hemorrhage of rectum and anus, hepatic cancer, hypertensive heart disease, infertility, male, inflammatory bowel disease, male infertility and abnormal spermatozoa, memory loss, muscle/tendon sprain, nasal polyps, neuralgia, neuritis, and radiculitis nos, non-melanoma skin cancer, nonrheumatic tricuspid valve disorders, open wound of finger(s), open wounds of extremities, other abnormal glucose, other disorders of metabolism, paraproteinemia, partial epilepsy, persistent mental disorders due to other conditions, polyarthropathy or polyarthritis involving multiple sites nos, posttraumatic stress disorder, primary/intrinsic cardiomyopathies, purpura and other hemorrhagic conditions, schizophrenia and other psychotic disorders, second degree av block, secondary malignancy of bone, skin cancer, spermatocele, subjective visual disturbances, symptomatic artificial menopause, transient alteration of awareness, unspecified polyarthropathy or polyarthritis, valvular heart disease/ heart chambers, vitamin b-complex deficiencies
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid