rs1385497 chr8:119067748 C>T
- Sequence
aatccaggcatgagtctccagaag[C/T]cctttccttccttaaaagcacctc
- ASB in cell types
- Detroit 562 (Pharyngeal squamous cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Detroit 562 (Pharyngeal squamous cell carcinoma) | -0.18 | 1.25 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Lung