rs1386190 chr14:42110268 C>T
- Sequence
cctttggctttgcttctttaactc[C/T]atgcacttctgttggcaggttttt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.40 | 0.65 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.43 | -3.71 | 2.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.80 | -0.59 | 1.00 |
Items per page:
1 – 3 of 3