rs1386209 chr12:129187158 A>G
- Sequence
gtgtgtggttttccaccagagggc[A/G]atagaggagtcctagggggatgga
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.38 | 1.94 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.01 | 1.69 | 1.33 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.66 | 2.18 | 1.00 |
Items per page:
1 – 3 of 3