rs1386452 chr11:19576191 C>A
- Sequence
agcatactcctttctgatcctcag[C/A]cacaaaataaacaggtaagggatc
- ASB in cell types
- upper lobe of left lung
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 2.62 | -4.84 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol