rs1387981 chr4:118954337 A>C
- Sequence
tttctcgctctttcttttttttcc[A/C]gtaactccagaaagattatgcatg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -1.35 | 1.67 | 1.00 |
Items per page:
1 – 1 of 1