rs1388617 chr3:151305381 T>A
- Sequence
cctgttttttttccagccacccat[T/A]ggtattttcctttggctattttac
- ASB in cell types
- HEK293 (embryonic kidney) HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.07 | 0.24 | 1.13 | |||
| HT29 (colon adenocarcinoma) | 1.55 | -0.55 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid