rs1389030 chr3:96538653 T>C
- Sequence
gtgatgaaaatcttacttctgtga[T/C]gaaattttacttctgtcatctttt
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | n/a | 2.19 | 1.00 | 3.63 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP salmonella-induced pyroptosis, serum creatinine, stabilized warfarin dose, tetrology of fallot