rs1389519 chr16:77438088 C>G
- Sequence
gacagagaatcatgagcccatgct[C/G]cagtcttggagttataaactgcaa
- ASB in cell types
- WA01 (H1, human embryonic stem cells) Peyer's patch GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 2.18 | -0.23 | 1.00 | |||
| Peyer's patch | -2.41 | 2.65 | 1.00 | |||
| GM23338 | -1.04 | 1.48 | 1.00 |
Items per page:
1 – 3 of 3