rs1393849 chr15:69303730 T>C
- Sequence
gggataaccgaccagtctgagaaa[T/C]gcagccagaggcccagggaagcct
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.44 | 1.74 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.34 | 2.38 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg