rs1393952 chr8:31827963 A>G
- Sequence
taaagaaatgagggtgtgtcccag[A/G]gggatctgtctgtggccagcagga
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | -1.84 | 2.30 | 1.50 | 4.61 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP body mass index (bmi), common carotid artery thickness (average of near and far wall measures), internal carotid artery thickness (average of near and far walls), ldl cholesterol, years of education