rs1394781 chr2:212384098 A>G
- Sequence
aggttatgagagtactgttaatac[A/G]ttccagacccagtggctacaaact
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.10 | 1.72 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, height, infant head circumference, partial epilepsy, sporadic creutzfeldt-jakob disease