rs1395480 chr4:177376239 C>T
- Sequence
agcttgctaagtggagcacagtgg[C/T]cacacatcttacgctggagggagc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -4.02 | 2.25 | 1.50 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -3.60 | 2.28 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, autism with low iq, diastolic blood pressure (dbp), dna repair capacity in cultured peripheral lymphocytes (bpde-damage host-cell reactivation testing) in lung cancer cases and controls, ldl cholesterol, longstanding arthritis, total cholesterol