rs139718045 chr1:109053323 C>G
- Sequence
gaccccgtctgggaactgaggagc[C/G]tctcggcccgaccgccaccccgtc
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- ZN611_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN611_HUMAN | 2.56 | n/a | 1.00 | 6.03 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
