rs1397657 chr4:60464215 C>T
- Sequence
actggtgacagggtcacttctctc[C/T]cccttgcactgcaaagcatagctg
- ASB in cell types
- GM02630 (Fanconi anemi) 2588 (Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.62 | -0.14 | 2.17 | n/a | n/a |
Items per page:
1 – 1 of 1