rs1398024 chr10:23376509 G>T
- Sequence
atgacaagctcatggcataaaata[G/T]gaatttccaactatataagaaata
- ASB in cell types
- MDM(monocyte derived macrophages)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.05 | n/a | 2.50 | -3.65 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), college completion, crohns disease, crohns disease and sarcoidosis, rheumatoid arthritis, sarcoidosis, tardive dyskinesia, transmission distortion, urinary albumin-to-creatinine ratio
PheWAS acidosis, actinic keratosis, angiodysplasia of intestine, apnea, arthropathy associated with neurological disorders, arthropathy associated with other disorders classified elsewhere, atrophic gastritis, barretts esophagus, blood in stool, chronic cystitis, complication of internal orthopedic device, diabetes mellitus, diseases of respiratory system, disorders of the globe, esophageal cancer, failure to thrive, fracture of ankle and foot, fracture of foot, fracture of tibia and fibula, gastric ulcer, hypermetropia, hypersomnia, impetigo, insect bite, lack of normal physiological development, malignant neoplasm of brain and nervous system, mechanical complication of nervous system device, implant, and graft, melanoma, mixed hyperlipidemia, morbid obesity, neoplasm of uncertain behavior, nephrotic syndrome without mention of glomerulonephritis, noninflammatory disorders of vulva and perineum, nonrheumatic tricuspid valve disorders, obesity, other abnormal glucose, other diseases of respiratory system, other disorders of stomach and duodenum, other dyschromia, other hypertensive complications, other infectious diseases, overweight, pain, swelling or discharge of eye, peritoneal or intestinal adhesions, persistent mental disorders due to other conditions, prurigo, pulmonary embolism and infarction, retinal drusen, sacroiliitis nec, sepsis, sepsis and sirs, sicca syndrome, sleep apnea, subjective visual disturbances, type 2 diabetes, ulceration of intestine, ulceration of the lower gi tract, ventral hernia