rs1398942 chr4:89009241 G>A
- Sequence
aagagaaatgagaatatgtggcct[G/A]agtcacgtagcatgcagttgcaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ARNT_HUMAN MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | 1.68 | -0.16 | 1.75 | -0.77 | Weak Concordant | |||
| MTG16_HUMAN | 2.26 | n/a | 2.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP alzheimers disease, ldl cholesterol, ldl cholesterol change with statins, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), maternal transmission distortion, paternal transmission distortion, total cholesterol, transmission distortion, triglycerides