rs1400733 chr2:205680199 C>G
- Sequence
gcttgagtccccagggatggaaac[C/G]tgagactcactctctgtccaactg
- ASB in cell types
- erythroid cells HMF (human mammary fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.47 | -4.70 | 2.00 | |||
| HMF (human mammary fibroblasts) | 2.21 | -1.68 | 1.00 |
Items per page:
1 – 2 of 2