rs1400825 chr2:179411161 T>C
- Sequence
tttgggatccaggcaacagagcca[T/C]cttgaagcacagccagtgaggccg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.17 | 1.18 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol change with statins, refractive error, schizophrenia, triglycerides change with statins, urinary albumin-to-creatinine ratio