rs1405332 chr3:54853755 G>C
- Sequence
gcagaagggcttcccagaggaggt[G/C]ggggaggactgcactcagcagata
- ASB in cell types
- foreskin keratinocyte GM18526 (B – cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.83 | 1.96 | 2.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.85 | -0.53 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.83 | 1.47 | 1.00 |
Items per page:
1 – 3 of 3