rs1405702 chr5:18455664 G>A
- Sequence
attaaaatgttctcaagacaattc[G/A]taaaaggatgaaatgtattgcacc
- ASB in cell types
- iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived chondrocytes | 1.02 | -0.04 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, fasting insulin, hdl cholesterol, homa-ir, total cholesterol, triglycerides