rs1405763 chr21:22575256 G>T
- Sequence
actttagggggagctctaacaaag[G/T]ctcacccaggaggagctgcgtgtc
- ASB in cell types
- IMR-5 (Neuroblastoma) TTC-1240 (Rhabdoid tumor of the kidney) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.24 | -0.32 | 1.48 | n/a | n/a |
Items per page:
1 – 1 of 1