rs1406553 chr12:80035885 A>G
- Sequence
agtatgcatatttatagctttggt[A/G]gacactgctaaatcacactccaaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.92 | -0.27 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, crohns disease, combined control dataset, gender differentiated, hepatitis b virus (hbv)-related hepatocellular carcinoma, hypertension (early onset hypertension), infant head circumference, ldl cholesterol, total cholesterol