rs1406750 chr2:122427465 A>G
- Sequence
gaagaggagatacttaataaacca[A/G]tcaagtatattgcatggattgtat
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 3.69 | -3.38 | 1.00 | -4.88 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), ldl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis, stabilized warfarin dose, total cholesterol, total cholesterol change with statins