rs1406858 chr20:38731516 T>C
- Sequence
ggacgtgctgcagaccctgtaagc[T/C]gtccccacctgggtccgcagcata
- ASB in cell types
- foreskin keratinocyte glioblastoma cells erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.24 | 2.00 | |||
| glioblastoma cells | n/a | 1.74 | 2.50 | |||
| erythroid cells | -4.51 | 1.98 | 2.00 |
Items per page:
1 – 3 of 3