rs1407688 chr13:53206789 G>A
- Sequence
aagtatatttctatgtagcattca[G/A]ttttaaactattctcttttttcca
- ASB in cell types
- foreskin keratinocyte SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.68 | 2.24 | 2.00 | |||
| SK-N-SH (neuroblastoma) | 1.93 | -1.64 | 1.00 |
Items per page:
1 – 2 of 2