rs1407689 chr13:53206736 G>T
- Sequence
agcaaacagctagaaaaccagccc[G/T]ggaacaactgaatattgtttacat
- ASB in cell types
- foreskin keratinocyte SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.33 | 2.35 | 2.00 | |||
| SK-N-SH (neuroblastoma) | 1.65 | -1.48 | 1.00 |
Items per page:
1 – 2 of 2