rs1407866 chr9:7137299 A>C
- Sequence
aattatgaatatccatgacatcat[A/C]tctaaatgttagggtagggctgaa
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | -1.14 | 1.20 | 1.00 | 1.58 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, infant head circumference, rheumatoid arthritis, triglycerides change with statins