rs1408060 chr13:75715844 G>C
- Sequence
acctgtgttatatataatgcctga[G/C]aggaaaacaaagtcagctgttcag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.14 | 2.05 | 1.50 | n/a | n/a | |||
| IKZF2_HUMAN | -0.61 | 1.87 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis