rs1409128 chr10:26861164 G>T
- Sequence
attgtagtctctcctaggctaggc[G/T]gcccgtccaaagcgcatgcgccca
- ASB in cell types
- foreskin keratinocyte MDM(monocyte derived macrophages) A673 (Ewing sarcoma)
- ASB for transcription factors
- ZN217_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN217_HUMAN | -1.57 | 1.88 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, arthritis including non-rheumatoid, bipolar disorder, diastolic blood pressure (dbp), hip bone mineral density (bmd), paternal transmission distortion, spine bone mineral density (bmd), total cholesterol, transmission distortion, years of education