rs1409751 chr10:14197066 C>G
- Sequence
cagcctgaagacccagaaacatcc[C/G]gatggatatttaagccagctcaga
- ASB in cell types
- A549 (lung carcinoma) WA01 (H1, human embryonic stem cells) sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.80 | 0.21 | 2.00 | |||
| WA01 (H1, human embryonic stem cells) | 1.09 | -0.28 | 1.38 | |||
| sigmoid colon | 1.36 | -0.51 | 1.00 |
Items per page:
1 – 3 of 3