rs1410075 chr10:14692802 C>T
- Sequence
cagaatgaacgttgtcttgctgca[C/T]gggccggggttattcaattatcct
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.56 | 0.69 | 1.75 | |||
| 22RV1 (prostate carcinoma) | 2.22 | -0.16 | 2.00 |
Items per page:
1 – 2 of 2