rs1412444 chr10:89243170 C>T
- Sequence
ttttatctatttgcctttaaacac[C/T]ggaaataacaccagtggcaacaac
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.80 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, ankle brachial index, coronary artery disease (cad), gene expression of lipa in liver, lipa transcript levels, stabilized warfarin dose, total cholesterol change with statins, waist hip ratio
PheWAS abnormal reflex, acute pancreatitis, altered mental status, althetes foot, alzheimers disease, arteritis nos, benign mammary dysplasias, benign neoplasm of breast, calculus of bile duct, cervical radiculitis, cholecystitis without cholelithiasis, cholelithiasis, cholelithiasis and cholecystitis, dementias, disorders of menstruation, dysuria, elevated levels of transaminase or lactic acid dehydrogenase, essential hypertension, fracture of humerus, fracture of tibia and fibula, history of diseases of digestive system, hypertension, infertility, female, insect bite, intervertebral disc disorders, irregular menstrual cycle/bleeding, lump or mass in breast, lymphosarcoma, malunion fracture, menopausal & postmenopausal disorders, myopia, nephritis and nephropathy in diseases classified elsewhere, nephrotic syndrome without mention of glomerulonephritis, osteopenia, osteoporosis, osteopenia, & pathological fractures, other biliary tract disease, other disorders of bone and cartilage, other disorders of ear, other disorders of urethra and urinary tract, other hypertensive complications, other nonmalignant breast conditions, other pulmonary inflamation or edema, other specified disorders of breast, otosclerosis, paroxysmal supraventricular tachycardia, partial epilepsy, peripheral arterial disease, polymyalgia rheumatica, postmenopausal bleeding, postmenopausal hormone replacement, reticulosarcoma, retinal detachment with retinal defect, retinal detachments and defects, rosacea, senile dementia, symptomatic menopause, symptoms involving urinary system, type 1 diabetic peripheral circulatory disorders, urinary tract infection, uterine leiomyoma
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood