rs14138 chr2:46187307 G>A
- Sequence
cattccacctggcagctgaaggca[G/A]ccagtcagtctgtcccagaaaggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.87 | 0.51 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, hypertension (early onset hypertension), postoperative nausea and vomiting, primary rhegmatogenous retinal detachment, rheumatoid arthritis, sporadic creutzfeldt-jakob disease