rs1413804 chr6:18836100 A>G
- Sequence
tcattggctttactgatctttacg[A/G]tgagtgtcttattagtcatctgaa
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- TBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | 1.02 | 2.84 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hypertension (early onset hypertension), systolic blood pressure (sbp), total cholesterol, triglycerides, waist hip ratio