rs1413875 chr8:36256721 C>A
- Sequence
aagtgcaggatacttggaatgtcc[C/A]gactacaggaacaaaggacatagt
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | 2.30 | -2.99 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, diastolic blood pressure (dbp), hdl cholesterol change with statins, hip bone mineral density (bmd), hypertension (early onset hypertension), ldl cholesterol, major depressive disorder