rs1415485 chr6:101670471 A>G
- Sequence
acatttattgtacctgatggctca[A/G]tggactatcaacatgagctcttaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.97 | -0.57 | 1.62 |
Items per page:
1 – 1 of 1