rs1415845 chr10:79071427 C>T
- Sequence
aggtacagataaagaggcaggcgc[C/T]ggggctggagagccgggcagcttg
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.01 | -0.12 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Whole_Blood