rs1416545 chr6:72412287 G>A
- Sequence
ctcactctgccacactagcatttg[G/A]ctcaaaattatgaacaagggtttg
- ASB in cell types
- epidermal keratinocytes SLK (Clear cell renal cell carcinoma. Derived from metastatic site: Skin.Clear cell renal cell carcinoma (NCIt: C4033) Derived from metastatic site: Skin)
- ASB for transcription factors
- SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC1A_HUMAN | 1.94 | 0.98 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1