rs1416546 chr6:72412204 A>G
- Sequence
tttgtgaatttcccctgctttatt[A/G]acaggcaaatagcagttgtattac
- ASB in cell types
- neural cell CD34+ stem cells-derived erythroblasts adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.41 | 0.56 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.83 | -0.18 | 2.00 | |||
| adrenal gland | -1.31 | 1.61 | 1.00 |
Items per page:
1 – 3 of 3