rs1417632 chr10:110746570 C>G
- Sequence
atggtggcattgctcagtcgaccc[C/G]gagtatttcaaggccggcaccaaa
- ASB in cell types
- WA01 (H1, human embryonic stem cells) foreskin keratinocyte thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 2.36 | 0.01 | 1.17 | |||
| foreskin keratinocyte | n/a | 0.41 | 3.00 | |||
| thoracic aorta | 0.99 | -0.99 | 1.00 |
Items per page:
1 – 3 of 3