rs1422447 chr5:128771097 C>T
- Sequence
agtcccatactttcccctaaagat[C/T]ggccttagacaaatgtttttcaca
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.21 | 0.47 | 1.00 | |||
| monocyte-derived dendritic cells | 2.28 | -1.54 | 2.00 |
Items per page:
1 – 2 of 2