rs1424452 chr18:34976852 G>C
- Sequence
agcgtcttcaggcgggtcggctcg[G/C]acctgcccagtggggcgcccacct
- ASB in cell types
- HEK293T (embryonic kidney) TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 2.94 | -5.36 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1